Diamondnado1918 Diamondnado1918
  • 01-10-2017
  • Chemistry
contestada

Which regions on the periodic table can adopt positive and negative oxidation numbers?

Respuesta :

barnuts
barnuts barnuts
  • 14-10-2017

The region(s) of the periodic table which are made up of elements that can adopt both positive and negative oxidation numbers are the “non-metal” region. As we can see on the periodic table, the elements situated at the right side of the table have two oxidation states, one positive and the other a negative. 

Answer Link

Otras preguntas

an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
What was George Washington's nickname?
Where did middle names come from
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
who was the founder of Pennsylvania?
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
four yardequal Blank feet