28jgordon 28jgordon

03-06-2022
Mathematics

contestada

Answer the following sections on parallels lines

Answer the following sections on parallels lines class=

Respuesta :

jrudd2729 jrudd2729

03-06-2022

Answer:

Parallel lines are lines that never meet and are always the same distance apart. Lines X, Y, and Z are all parallel to each other.

Step-by-step explanation:

Answer Link

yazzie2021 yazzie2021

03-06-2022

Parallel lines are lines that never meet.
The line crossing them isn’t parallel

Answer Link

Otras preguntas

The federalist papers were published in 1787 and 1788 to help gain support for

What is the value of [(2/3)^0]^-3

Farmer brown built a rectangular pen for his chickens using 12 meters of fence. • he used part of one side of his barn as one length of the rectangular pen. • h

how many moles of NaCl are equivalent to 15.6g NaCl

the influence of Greek and Roman culture on some Renaissance art is reflected in what

why did the church oppose the heliocentric theory

The 1954 supreme court case that ruled racially segregated school systems "inherently unequal" was

In the reversible reaction shown below, r moles of a react with s moles of b to produce t moles of c. which equation can be used to represent the equilibrium co

Why did some americans feel that the united states should help europe after world war ii?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat