trentwilson511 trentwilson511
  • 03-01-2017
  • English
contestada

Based on what is known about Stalin from history, which statement from his speech is the best example of hypocrisy?

Respuesta :

taskmasters
taskmasters taskmasters
  • 11-01-2017

Stalin gave a speech at Lenin’s funeral. It was indeed an example of hypocrisy. He delivered a eulogy and gave flattering remarks about Lenin. However, it is not a truthful and honest speech since Stalin feels quite relieved that Lenin had finally died because if not, he will be removed from his position that time. 

Answer Link

Otras preguntas

Step by step directions Square root for 480
What is the difference between "Herr" and "Herrn"?
What is the primary purpose of the Supremacy Clause?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
Do you think then solid can undergo convection
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The Panama Canal connects what two bodies of water?