LaMaya16 LaMaya16

02-02-2021
Biology

contestada

Explain the process of photolysis inside the chloroplast
need ASAP

Respuesta :

ZaynoAckerman ZaynoAckerman

02-02-2021

Photosynthesis is the process which the plant take in sunlight through leaf and carbon dioxide from to form glucose and oxygen.

I hope it helped!

Answer Link

Otras preguntas

Word: Burlap The question is in the picture.

In the figure below, the two adjacent polygons are regular. What is the measure of ∠ABC?

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

If Levi purchased a total of 50 ride tickets and game tickets at the amusement park and spent $29. If right tickets cost $.75 each and game tickets cost $.50 ea

4. Cross out the things that are not common to all living things. a. Photosynthesis b. Cellular respiration c. Need for energy d. DNA e. Ribosomes f. Nucleus g.

2x to the power of 2 when x=3

A pool charges an $8 admission fee plus $1.50 per hour swim. Miranda has $26 and wants to know how many hours she can swim. The equation for this 8 + 1.5h =26.

What belief did reforms hold about insanity

What element of a crisis management plan defines the process that should unfold once an issue or crisis is identified? Hint: it also includes information about

What is the volume? 17 cm 13 cm 5 cm It’s a triangular prism.