arquelalaster28
arquelalaster28 arquelalaster28
  • 02-11-2020
  • Mathematics
contestada

what is the solution of the system of equations: -2x+8y=-8 and 5x-8y=20​

Respuesta :

amossunny amossunny
  • 02-11-2020

Answer:

x=4 y=0

Step-by-step explanation:

You add the two equations together to get 3x=12. You derive x=4 and y=0 from that.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the solution 4x+1y ≤48 and 10 ≤y ?
What is the requirement when ratifying a proposed amendment to the United States Constitution? A. approval of three quarters of states in a state convention B.
Monocytes are a type of white blood cell that can differentiate into what two cells?
A newly formed country in the Caribbean has no high tariffs, yet other countries find it difficult to trade with the new country because of its requirements for
Can someone Help me with that please
Which of these sentences is punctuated correctly? Although the concert doesn't start for over an hour; most of the fans have already arrived at the concert hal
The reason why vanessa did not include sports skills activities in her program was that she:
Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2
An important change in the american family in the nineteenth century was