princecedie112606 princecedie112606

01-11-2020
Social Studies

contestada

"A President doesn't always win the popular vote." Explain this statement.

Respuesta :

genesislesperance genesislesperance

01-11-2020

Answer:

sometimes he isint always liked but he usally has the coutrys best intrest in mind

Explanation:

Answer Link

Otras preguntas

Which of the following are considered irregular verbs? Poner and lavar Poner and hacer Bañar and poner Lavar and hacer

Which type of intelligence allows people to use their vision to develop mental images?

The tendency for people to become more extreme in their attitudes as a result of group discussion is called _______.

Find the length of the missing side of a right triangle if a=6 and c=11

Latin prefix opposite of mini-

Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.

Need help ASAP !!!!!!!

[tg.02]carbon in food molecules is transferred from animals to the geosphere through the process of

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How did japan gain territory and control of areas of china during world war 1?