churchillvanessam churchillvanessam

03-10-2020
Chemistry

contestada

For NH4NO3(s) write a balanced thermochemical equation.

Respuesta :

sagarsaud666 sagarsaud666

03-10-2020

Answer:

step1

NH4NO3(s)+H2O(I)--------->NH⁴OH(aq)+HNO³(aq)

step²

NH⁴OH(aq)+HNO³(aq)-------->NH⁴+(aq)+NO³-(aq)+H²O(I)

Answer Link

Otras preguntas

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

The temperature on a cloudy night is likely to be __________ those on a clear night all other factors being equal

SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand

True or False. An object's mass will change if you move it from the Earth to the Moon.

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)

Please help I'm trying to figure out 4-15 but i don't know how to.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Can things of aluminum have a greater mass than things made of iron?

plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.

What country did Texas break away from to become independent?