rand17
rand17 rand17
  • 03-10-2018
  • Chemistry
contestada

how can volume be determined?

Respuesta :

mimiwhatsup
mimiwhatsup mimiwhatsup
  • 03-10-2018

Volume is a solid and is expressed in cubic measurements, such as cubic centimeter or cubic meter.

Answer Link

Otras preguntas

Solve for x in terms of the other matrices and/or their inverses. x=b+ax
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
If a family has three children, what is the probability that the family has at least one girl?
The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is
The _______ was Franklin Roosevelt's program designed to fight the Great Depression
If aspartame is successfully hydrolyzed, the products are methanol, phenylalanine and aspartic acid. what two functional groups must be hydrolyzed for this reac
When a circular pizza is cut into six slices using diameters, the total length of the cuts is 18 cm. what is the area of the pizza in square centimeters?
Which type of intelligence allows people to use their vision to develop mental images?
Biggest reason why the united states did not want to enter world war 1
a food worker prepares a raw fish fillet for cooking. what food hazard must be removed during preparation?