badrouszaynab badrouszaynab

02-09-2018
Mathematics

contestada

can anyone help me with this pls? i have no idea what im doing

can anyone help me with this pls i have no idea what im doing class=

Respuesta :

konrad509 konrad509

02-09-2018

[tex] h(11)=-20+11\cdot11=-20+121=-101 [/tex]

Answer Link

Otras preguntas

What is a characteristic for Photosynthesis

Find the perimeter of the rectangle, 4.3 yd 2.6 yd The perimeter of the rectangle is

Which of the following is LEAST characteristic of a complex organism? A) cephalization B)symbiotic relationship C)bilateral symmetry D) specialized tissues an

The percent by mass of bicarbonate (HCO3−) in a certain Alka-Seltzer product is 32.5 percent. Calculate the volume of CO2 generated (in mL) at 37°C and 1.00 atm

The Roman Republic ADD TO FAVORITES VIDEO VOCAB CARDS VOCAB GAME READ & RESPOND QUIZ LYRIC LAB Read & RespondQuestion 2 of 6 Use the text below to answe

Calculate the [H+] in a solution that is 0.803 M in NaX and 0.677 M in HX given that the Ka of HX is 8.64 ⋅ 10 − 7 8.64⋅10-7. Report your answer in scientific n

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Rhonda has an adjusted basis and an at-risk amount of $23,600 in a passive activity at the beginning of the year. She also has a suspended passive activity loss

which ordered pair is the solution to the system of linear equations y=5x+8 and y= -4x-1

what decimal is equivalent to 1 5/8